In this module, we will learn:
- what a reference genome is and what it contains
- details about the FASTA and GTF formats
- to appreciate the differences in gene identifiers
- how to download a reference genome
Here we will set the stage for steps 5 and 6 by discussing reference genomes, which are integral to genome alignments and gene/isoform quantification. Along the way we will touch on some quirks to be aware of.
Step | Task |
---|---|
1 | Experimental Design |
2 | Biological Samples / Library Preparation |
3 | Sequence Reads |
4 | Assess Quality of Raw Reads |
5 | Splice-aware Mapping to Genome |
6 | Count Reads Associated with Genes |
:--: | ---- |
7 | Organize project files locally |
8 | Initialize DESeq2 and fit DESeq2 model |
9 | Assess expression variance within treatment groups |
10 | Specify pairwise comparisons and test for differential expression |
11 | Generate summary figures for comparisons |
12 | Annotate differential expression result tables |
A reference genome consists of the reference sequence and, optionally, any number of genomic annotations that describe attributes about that sequence. Examples of annotations include:
- Gene models consisting of the location and other information about genes.
- Variants consisting of the location of common or rare genetic variants, their alleles, and frequencies.
- Small RNAs consisting of the location and other information about various types of small RNAs.
Of particular relevance to us for this workshop are the reference sequence and gene models.
Reference sequence is stored in FASTA files. They are similar to FASTQ files in their storage of sequence information, but their format is a little different in a couple ways:
-
Records are separated by lines beginning with
>
instead of@
. -
Only the sequence is stored in a FASTA file, there is no notion of quality attached to the nucleotides.
chrM GATCACAGGTCTATCACCCTATTAACCACTCACGGGAGCTCTCCATGCAT TTGGTATTTTCGTCTGGGGGGTGTGCACGCGATAGCATTGCGAGACGCTG GAGCCGGAGCACCCTATGTCGCAGTATCTGTCTTTGATTCCTGCCTCATT CTATTATTTATCGCACCTACGTTCAATATTACAGGCGAACATACCTACTA AAGTGTGTTAATTAATTAATGCTTGTAGGACATAATAATAACAATTGAAT GTCTGCACAGCCGCTTTCCACACAGACATCATAACAAAAAATTTCCACCA AACCCCCCCCTCCCCCCGCTTCTGGCCACAGCACTTAAACACATCTCTGC CAAACCCCAAAAACAAAGAACCCTAACACCAGCCTAACCAGATTTCAAAT TTTATCTTTAGGCGGTATGCACTTTTAACAGTCACCCCCCAACTAACACA
Well-characterized organisms (e.g. human, mouse, zebrafish) have fairly mature gene models. These are stored in GTF format, which gives location and other information about each gene feature. Below are two examples:
chr1 unknown exon 11874 12227 . + . gene_id "DDX11L1"; gene_name "DDX11L1"; transcript_id "NR_046018"; tss_id "TSS16932";
chr1 unknown exon 12613 12721 . + . gene_id "DDX11L1"; gene_name "DDX11L1"; transcript_id "NR_046018"; tss_id "TSS16932";
chr1 unknown exon 13221 14409 . + . gene_id "DDX11L1"; gene_name "DDX11L1"; transcript_id "NR_046018"; tss_id "TSS16932";
chr1 unknown exon 14362 14829 . - . gene_id "WASH7P"; gene_name "WASH7P"; transcript_id "NR_024540"; tss_id "TSS8568";
1 havana gene 11869 14409 . + . gene_id "ENSG00000223972"; gene_version "5"; gene_name "DDX11L1"; gene_source "havana"; gene_biotype "transcribed_unprocessed_pseudogene";
1 havana transcript 11869 14409 . + . gene_id "ENSG00000223972"; gene_version "5"; transcript_id "ENST00000456328"; transcript_version "2"; gene_name "DDX11L1"; gene_source "havana"; gene_biotype "transcribed_unprocessed_pseudogene"; transcript_name "DDX11L1-202"; transcript_source "havana"; transcript_biotype "lncRNA"; tag "basic"; transcript_support_level "1";
1 havana exon 11869 12227 . + . gene_id "ENSG00000223972"; gene_version "5"; transcript_id "ENST00000456328"; transcript_version "2"; exon_number "1"; gene_name "DDX11L1"; gene_source "havana"; gene_biotype "transcribed_unprocessed_pseudogene"; transcript_name "DDX11L1-202"; transcript_source "havana"; transcript_biotype "lncRNA"; exon_id "ENSE00002234944"; exon_version "1"; tag "basic"; transcript_support_level "1";
The GTF format stores specific information in each column:
Column | Description |
---|---|
1 | Chromosome |
2 | Source, e.g. ensembl, havana |
3 | Gene feature, e.g. exon, intron, mRNA, transcript |
4 | Start location, 1-based |
5 | End location, 1-based |
6 | Score |
7 | Strand |
8 | Frame, relating to codons |
9 | Attribute, a semicolon separated list of key/value pairs giving additional information about the feature. |
Bioinformatics is a relatively new, fast-changing, field and its data standards and formats are no different. Consequently there are some oddities and tedious items of note which we would like to only briefly touch on here.
On occassion new reference genomes are released, and the genome build number changes. You may be familiar with the UCSC manner of naming human genome builds: hg18, hg19, hg38. ENSEMBL, naturally, has their own way of referring to genome builds: GRCh36, GRCh37, and GRCh38. Notice with the most recent human reference, the numbering now aligns between UCSC and ENSEMBL.
Different organisms have their own versioning.
NCBI RefSeq, ENSEMBL, and UCSC Known Genes are the three primary gene annotation databases (different organisms have their own databases). We will not go into exactly how the gene annotations are different, but we note that the are, and others have examined the consequences of this.
The two GTF examples above highlight different ways of referring to the same gene. In the first GTF we see:
- DDX11L1, the gene symbol, controlled by the Human Gene Nomenclature Committee (HUGO).
- NR_046018, the RefSeq transcript ID
And in the second GTF we see:
- ENSG00000223972, the ENSEMBL gene ID
- DDX11L1, the gene symbol, thankfully the same
- ENST00000456328, the ENSEMBL transcript ID
Translating between different gene IDs is possible, as we will see in Day Two with biomaRt
. But in terms of best practice it is generally a good idea to avoid using the gene symbol as the primary gene identifier because not everyone refers to the same gene by the same symbol.
The Illumina iGenomes resource is one of the easiest, and most comprehensive, ways to download a reference genome. iGenomes includes both the reference sequence and gene models.
Reference genomes can be very large, depending on the organism, and so we will not download one to the Amazon instance we are using for this workshop. We've included instructions for downloading these, in case you want to download these to the server where you intend to later do a similar RNA-seq analysis (e.g. on High-Performance Compute, GreatLakes).
How would I download references with iGenomes?
As noted, it's not recommended to download the iGenomes references to the AWS instance. However, if you wanted to know in general how you would do that, the process is described here.
First go to the iGenomes page, find the build you want from the source you want, right click the genome build you want to download, and select "Copy link location":
Then on the remote server you would go to the directory you'd like to download the genome to and type (that URL is what we copied):
$ wget http://igenomes.illumina.com.s3-website-us-east-1.amazonaws.com/Homo_sapiens/NCBI/GRCh38/Homo_sapiens_NCBI_GRCh38.tar.gz
After the download finishes (it may take a while as it is tens of GB large), you can unpack it with:
$ tar -xf Homo_sapiens_NCBI_GRCh38.tar.gz
The key is to be consistent in your research. Switching from ENSEMBL to UCSC will create many headaches because of the change in gene identifiers, and differences in the gene models themselves. Often people choose the one they're most comfortable with, which is often a function of historical accident. The key is not to overthink it.
Another important note is not to mix the sources. If you download reference sequence from UCSC, don't use an ENSEMBL GTF (and vice versa). One of the quirky differences between the two databases is that ENSEMBL refers to chromosome only by their number, i.e. 1
, whereas UCSC refers to chromsomes as chr1
. This makes reference FASTAs from one source incompatible with gene builds from another.
These materials have been adapted and extended from materials created by the Harvard Chan Bioinformatics Core (HBC). These are open access materials distributed under the terms of the Creative Commons Attribution license (CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.