Update BioMarkovChains.jl to improve "Get Started" section and packag…

…e installation instructions

docs/src/getstarted.md

@@ -20,15 +20,16 @@ seq = dna"CCTCCCGGACCCTGGGCTCGGGAC"
 
 BioMarkovChain(sequence)
 ```
-
-  BioMarkovChain of DNAAlphabet{4}() and order 1:
-    - Transition Probability Matrix -> Matrix{Float64}(4 × 4):
-     0.0     1.0     0.0     0.0
-     0.0     0.5     0.2     0.3
-     0.25    0.125   0.625   0.0
-     0.0     0.6667  0.3333  0.0
-    - Initial Probabilities -> Vector{Float64}(4 × 1):
-     0.087   0.4348  0.3478  0.1304
+```
+BioMarkovChain of DNAAlphabet{4}() and order 1:
+  - Transition Probability Matrix -> Matrix{Float64}(4 × 4):
+   0.0     1.0     0.0     0.0
+   0.0     0.5     0.2     0.3
+   0.25    0.125   0.625   0.0
+   0.0     0.6667  0.3333  0.0
+  - Initial Probabilities -> Vector{Float64}(4 × 1):
+   0.087   0.4348  0.3478  0.1304
+```
 
 Note that, sometimes the dinucleotides transition do not harbor important biological meaning, whereas trinucleotides or codons are, in
 fact, the building block of proteins. Therefore, sometimes the transition model we want to build is usually a second-order Markov chain, that represents the possible transitions of a trinucleotide.
@@ -38,12 +39,13 @@ A very nice nice property of the transition probability matrix is that the *n-st
 ``` julia
 BioMarkovChain(sequence, 2)
 ```
-
-  BioMarkovChain of DNAAlphabet{4}() and order 2:
-    - Transition Probability Matrix -> Matrix{Float64}(4 × 4):
-     0.0     0.5     0.2     0.3
-     0.05    0.475   0.325   0.15
-     0.1562  0.3906  0.4156  0.0375
-     0.0833  0.375   0.3417  0.2
-    - Initial Probabilities -> Vector{Float64}(4 × 1):
-     0.087   0.4348  0.3478  0.1304
+```
+BioMarkovChain of DNAAlphabet{4}() and order 2:
+  - Transition Probability Matrix -> Matrix{Float64}(4 × 4):
+   0.0     0.5     0.2     0.3
+   0.05    0.475   0.325   0.15
+   0.1562  0.3906  0.4156  0.0375
+   0.0833  0.375   0.3417  0.2
+  - Initial Probabilities -> Vector{Float64}(4 × 1):
+   0.087   0.4348  0.3478  0.1304
+```