Extract a section of a reference genome assembly flanking a SNP from an input tag.
Designed as part of a project with the Molecular Genetics Laboratory (MGL) at the Fisheries and Oceans Canada Pacific Biological Station (PBS).
Warning: this pipeline is provided as is, without any guarantee of usefulness.
All scripts are to be run from the main folder.
General overview:
0. Prepare input data (project-specific)
- BLAST search the genome
- Identify target range
- Obtain target range
- Rename amplicons
- Reverse complement necessary amplicons
- Select specific amplicons
Put original files in 02_input_data
:
tpac_adaptive_loci_2018-03-22.csv
tpac_neutral_loci_2018-03-22.csv
Original format:
Loci_name,Loci_Sequence,SNP_location
Tpa_0002,GTTCGTTCAGTCTAAAGAGAATAATAGGACCGGGAGGTTTGTACTTATGTAATAGACACAC[A/T]CACATACATATGCGCA,62
Put genome contig assembly in 02_input_data/genome
:
tpac_assembly/tpac_assembly_v1/tpac-contigs_min200.fa
Concatenate input files, remove header, remove rest of line after first colon (occurs when multiple SNP locations):
cat 02_input_data/<your_markers>.csv | grep -vE 'Loci_name' - | awk -F":" '{ print $1 }' - > 02_input_data/input_loci.csv
Determine the position of the first SNP in the locus based on presence of a square bracket:
awk -F, '{ print $2 }' 02_input_data/input_loci.csv | while read l ; do echo $l | cut -d[ -f1 | wc -c ; done > 02_input_data/first_snp_position.csv
note: wc -c counts the end of line character, so the position given will be truly the SNP position w/ a 1-base counting system.
Add position to the original file
paste -d, 02_input_data/input_loci.csv 02_input_data/first_snp_position.csv > 02_input_data/input_loci_w_pos.csv
Select columns of interest and put into FASTA format:
awk -F"," '{ print ">"$1"-"$4"\n"$2 }' 02_input_data/input_loci_w_pos.csv > 02_input_data/input_loci_w_pos.fa
Remove characters ([]/) to prevent issues with BLAST:
sed 's/\[//g' 02_input_data/input_loci_w_pos.fa | sed 's/\///g' - | sed 's/]//g' - > 02_input_data/input_loci_w_pos_no_badchar.fa
Rename and delete intermediate files:
mv 02_input_data/input_loci_w_pos_no_badchar.fa 02_input_data/prepared_tags.fa
mv 02_input_data/*.csv 02_input_data/input_loci_w_pos.fa 02_input_data/z-draft_input/
The output looks like this, where the accession name is '>markername-firstSNPposition'
:
>Tpa_0012-44
TCAGTGAGGCCCACTTCCTGGGTTTCCATCGACACACACACACCACGCTAGTGGATGGAGGGAAGGACGATTCAGGGA
Fix the names of the contig assembly accessions, removing spaces, commas, '+' or dashes. Change the GENOME variable to the genome you will be using:
GENOME="./02_input_data/genome/GCF_006149115.1_Oner_1.0_genomic.fna"; sed 's/\ /\_/g' $GENOME | cut -d, -f1 | sed 's/\+//g' - | sed 's/\-//g' - > ${GENOME%.f*}_renamed.fa
Set up genome file as a blast database
GENOME="./02_input_data/genome/GCF_006149115.1_Oner_1.0_genomic_renamed.fa; makeblastdb -in $GENOME -parse_seqids -dbtype nucl
Print name of contig, then the length of the contig (tab sep, to be used by R script below)
GENOME="02_input_data/genome/tpac-contigs_min200_renamed.fa" ; cat $GENOME | awk '$0 ~ ">" {print c; c=0;printf substr($0,2,100) "\t"; } $0 !~ ">" {c+=length($0);} END { print c; }' | tail -n+2 > 02_input_data/genome/ref_genome_seq_lengths.txt
This will be used by an Rscript below to ensure amplicon windows don't go beyond the contig size.
Use BLAST to align the loci to the genome:
blastn -db ./02_input_data/genome/tpac-contigs_min200_renamed.fa -query ./02_input_data/prepared_tags.fa -out 03_blast_out/prepared_tags_v_tpac-contigs_outfmt6.txt -outfmt 6 -evalue 1e-20
Retain only those loci that have two or fewer hits:
# Find loci names that map more than two times:
awk '{ print $1 }' 03_blast_out/prepared_tags_blast_outfmt6.txt | sort -n | uniq -c | sort -nk1 | awk '$1 > 2 { print $2 }' - > 03_blast_out/bad_loci.txt
# Then extract these from the BLAST output:
grep -vf 03_blast_out/bad_loci.txt 03_blast_out/prepared_tags_blast_outfmt6.txt > 03_blast_out/prepared_tags_blast_outfmt6_rem_multimap.txt
# Sort the BLAST output:
sort -k1,1 -k12,12gr -k11,11g -k3,3gr 03_blast_out/prepared_tags_blast_outfmt6_rem_multimap.txt > 03_blast_out/prepared_tags_blast_outfmt6_rem_multimap_sort.txt
Keep only a single record per accession:
DATA="03_blast_out/prepared_tags_blast_outfmt6_rem_multimap_sort.txt" ; for i in $(cut -f1 $DATA | sort -u); do grep -w -m 1 "$i" $DATA; done > ${DATA%.txt}_single_hit.txt
Use Rscript 01_scripts/identify_req_region_w_BLAST.R
This will use as inputs the single hit per blast query, and will find the target window, making sure to not go before the start of the reference contig, nor past the end of the reference contig. In these two cases, the start of the window will be the beginning or the end of the window will be the length of the contig, respectively.
This will output:
04_extraction/ranges_for_amplicon_extraction.bed
04_extraction/ranges_for_amplicon_extraction.csv
The bedfile is for extraction, the .csv gives additional useful information for determining identified positions.
Collect the target sequence using the bed file (from above) and the genome assembly, using bedtools:
GENOME="02_input_data/genome/GCF_006149115.1_Oner_1.0_genomic_renamed.fa" ; bedtools getfasta -fi $GENOME -bed 04_extraction/ranges_for_amplicon_extraction.bed -fo 04_extraction/amplicon_approx_by_BLAST.fa
Turn fasta into tab separated file for ease of renaming amplicons:
awk 'BEGIN{RS=">"}{print $1"\t"$2;}' 04_extraction/amplicon_approx_by_BLAST.fa | tail -n+2 > 04_extraction/amplicon_approx_by_BLAST.txt
Note: the tail -n+2 removes an empty first line (from https://www.biostars.org/p/235052/ )
Identify duplicate markers based on genomic coordinates by runnning the Rscript 01_scripts/identify_duplicates.R
. This will produce the following:
- 05_amplicons/data_suppl_all_with_duplicates.csv (all information including duplicates)
- 05_amplicons/dropped_duplicates_suppl_info.csv (all information without duplicates)
- 05_amplicons/dropped_duplicates.csv (simple info with mname and match.id of dropped duplicates)
Make files that contain top priority markers that you want to be sure not to remove. These should be in the format of CSV file, with mname, source
where mname is the name of the marker, and the source is the name of the source for the marker. These need to all be named as 02_input_data/<source>_priority1_mnames.csv
Use the script 01_scripts/drop_pref_dups_and_rename.R
Produces: 05_amplicons/all_fields.txt
Rename and format a fasta file with all amplicons:
awk -F"\t" '{ print ">"$1"__"$2"__"$3"__"$4"\n" $5 }' 05_amplicons/all_fields.txt | sed 's/\:/_/g' - > 05_amplicons/all_amplicons.fa
Note the removal of the bed file character ':'.
This will give you names showing:
>refgenomeContigID_bedrange__queryLocus__SNPposInExtractedSegment__ForOrRevOrient
SEQUENCESEQUENCESEQUENCE
Select forwards and put into file:
grep -A1 '__for' 05_amplicons/all_amplicons.fa | grep -vE '^--$' - > 05_amplicons/forward_amplicons.fa
Select reverses and put into file:
grep -A1 '__rev' 05_amplicons/all_amplicons.fa | grep -vE '^--$' - > 05_amplicons/to_be_revcomp_amplicons.fa
Using E. Normandeau's reverse complement script ( https://github.com/enormandeau/Scripts )
fasta_reverse_comp.py ./05_amplicons/to_be_revcomp_amplicons.fa ./05_amplicons/revcomped_amplicons.fa
Combine
cat 05_amplicons/forward_amplicons.fa 05_amplicons/revcomped_amplicons.fa > 05_amplicons/completed_all_amplicons.fa
Select out the top priority (1 and 2) amplicons:
cat 02_input_data/*priority*.csv | awk -F, '{ print "__"$1"__" }' - | xargs -I{} grep -A1 {} 05_amplicons/completed_all_amplicons.fa | grep -vE '^--$' - > 05_amplicons/priority_amplicons_all.fa
How many?
grep -cE '^>' 05_amplicons/priority_amplicons_all.fa
Put a file into 02_input_data/
with the name <source>_priority3_mnames.csv
, with two columns, csv, mname and FST. Use the following to pull these priority three out of the fasta:
awk -F, '{ print "__"$1"__" }' 02_input_data/*priority3*.csv | xargs -I{} grep -A1 {} 05_amplicons/completed_all_amplicons.fa | grep -vE '^--$' - > 05_amplicons/priority3_amplicons_all.fa
How many?
grep -cE '^>' 05_amplicons/priority3_amplicons_all.fa
Finally, put a file into 02_input_data/<source>_priority4_mnames.csv
as above. This is sorted by FST. Take the number needed to make your full complement:
Currently assumed sorted with highest FST at top
How many priority amplicons do you have?
cat 05_amplicons/priority*.fa | grep -cE '^>' -
awk -F, '{ print "__"$1"__" }' 02_input_data/larson_priority4_mnames.csv | xargs -I{} grep -A1 {} 05_amplicons/completed_all_amplicons.fa | grep -vE '^--$' - > 05_amplicons/priority4_amplicons_all.fa
Add all together in descending importance order, then take the number of amplicons x 2 from the fasta:
cat 05_amplicons/priority_amplicons_all.fa 05_amplicons/priority3_amplicons_all.fa 05_amplicons/priority4_amplicons_all.fa | head -n 1200 > 06_output/all_amplicons.fa
Collect the sequence and allele information from the first step for only those in the panel:
grep -E '^>' 06_output/all_amplicons.fa | awk -F"__" '{ print $2 }' - | xargs -I{} grep {}"," 02_input_data/z-draft_input/input_loci.csv > 06_output/all_amplicons_seq_and_alleles.csv
Will need the following 'alleles only' file for the Rscript:
awk -F"[" '{ print $2 }' 06_output/all_amplicons_seq_and_alleles.csv | awk -F"]" '{ print $1 }' - | sed 's/\//,/g' - > 06_output/alleles_only.txt
Also need the text version of the amplicon panel:
awk 'BEGIN{RS=">"}{print $1"\t"$2;}' 06_output/all_amplicons.fa | tail -n+2 > 06_output/all_amplicons.txt
Then use the Rscript 01_scripts/collect_required_info_for_sub_form.R
This Rscript will merge all the collective data, including the radtags, the amplicon text, the scaffold names.
Followed by the Rscript 01_scripts/figuring_out_other_method_of_inserting_alleles.R
This Rscript will use the flanking region either before or after the SNP in the radtag file to match against the amplicon sequence, split the amplicon sequence at the expected site of the polymorphism, insert the alleles in square brackets, calculate where this insertion occurred and compare against where the insertion was expected. If they vary too much (e.g. > 5 bp), then this amplicon will be removed, as the flanking region resulted in non-specific identification of polymorphism location. Finally, only the top markers based on Fst will be retained, to a total of 600 markers. These will be output in the format required by the synthesis company.
This will finally output a file entitled 06_output/amplicon_panel_v<version_number>.csv