########################################
# CrisprCon		               #
# Crispr/Cas allele analysis. 	       #
# EMBL-EBI 			       #
########################################

# PROJECT URLs:
https://github.com/mpi2/crisprcon
http://www.mousephenotype.org/

# CONTACT:
International Mouse Phenotyping Consortium (IMPC):
[email protected]

Mouse Informatics Project leader:
Terry Meehan ([email protected])


############
# CONTENTS # 
############

1. General Information
2. Variant calling (crispFa)
3. gRNA consequence prediction (crispRNA)

# Last updated: June 2018


##########################
# 1. General Information #
##########################


# Reference genome
All variant calls are relative to a reference genome, e.g: C57BL/6J (GRCm38).
An example of the last major release of the reference genome can be found here:
ftp://ftp.ncbi.nlm.nih.gov/genomes/archive/old_genbank/Eukaryotes/vertebrates_mammals/Mus_musculus/GRCm38/

# Annotation file
A GFF file is used for the consequence prediction of the variants.
An example of a GFF file can be found here:
ftp://ftp.ensembl.org/pub/release-92/gff3/mus_musculus/Mus_musculus.GRCm38.92.gff3.gz


Usage: ./crisprcon.py [-h] {crispFa,crispRNA}

    crispFa           Variant caller for CRISPR edited alleles
    crispRNA          gRNA consequence predictor. It takes the coordinates of
                      gRNA and it outputs a VCF with the predicted
                      consequences

#####################################
# 2. Variant calling (crispFa)      #
#####################################


Usage: ./crisprcon.py crispFa [-h] [-i INPUT_FA] [-o OUTPUT_VCF] [-f REF_GENOME]
                        [-r COORDS] [-g GFF] [-d OUT_DIR] [-t TEMP_DIR]
                        [-p PREFIX] [-c GRNA GRNA]

Positional arguments:
  -i INPUT_FA, --input INPUT_FA
                        Input FASTA.
  -o OUTPUT_VCF, --output OUTPUT_VCF
                        Output VCF file.
  -f REF_GENOME, --fasta-ref REF_GENOME
                        Reference file in fasta format (must be .fai indexed)
  -r COORDS, --region COORDS
                        Coordinates of CRISPR/Cas target region (ie: chr:start-end)
  -g GFF, --gff-annot GFF
                        gff3 annotation file

Optional arguments:
  -d OUT_DIR, --dir OUT_DIR
                        Optional: Directory for the output files. If not present, it will be created. Default: current directory
  -t TEMP_DIR, --temp TEMP_DIR
                        Optional: Directory for temporary and intermediate files. Default: creates "temp" directory at the output directory
  -p PREFIX, --prefix PREFIX
                        Optional: Prefix for temporary files. Default: input_name
  -c GRNA GRNA, --crispr-grna GRNA GRNA
                        Optional: gRNA pair coordinates used for CRISPR. Advised for validation of indels and potential false positives. Use different flags for more than one pair.
                        Eg: -c 72206978 72207000 -c 72206982 72207004
  -h, --help            Show this help message and exit



##############################################
# 3. gRNA consequence prediction (crispRNA)  #
##############################################


Usage: crispCon crispRNA [-h] [-o OUTPUT_VCF] [-f REF_GENOME] [-g GFF]
                         [-c GRNA GRNA] [-s DONOR] [-d OUT_DIR] [-t TEMP_DIR]
                         [-p PREFIX]

Positional arguments:
  -o OUTPUT_VCF, --output OUTPUT_VCF
                        Output VCF file.
  -f REF_GENOME, --fasta-ref REF_GENOME
                        Reference file in fasta format (must be .fai indexed)
  -g GFF, --gff-annot GFF
                        gff3 annotation file
  -c GRNA GRNA, --crispr-grna GRNA GRNA
                        gRNA pair coordinates and sequence used for CRISPR (sequence chr:start-end). Use different flags for more than one pair. 
			Eg: -c GATTCTGGCATCATCTATGTGGG 1:72206978-72207000 -c GCTTCTGCCAATATCTATTTGGG 1:72206982-72207004
  -s DONOR, --seq-donor DONOR
                        Sequence of the oligo donor

Optional arguments:
  -d OUT_DIR, --dir OUT_DIR
                        Optional: Directory for the output files. If not present, it will be created. Default: current directory
  -t TEMP_DIR, --temp TEMP_DIR
                        Optional: Directory for temporary and intermediate files. Default: creates "temp" directory at the output directory
  -p PREFIX, --prefix PREFIX
                        Optional: Prefix for temporary files. Default: input_name
  -h, --help            Show this help message and exit