Merge pull request #1096 from ethanwhite/loops-updates

Updates to loops assignment

assignments/r-iteration-2.md

@@ -3,8 +3,8 @@ layout: page
 element: assignment
 title: Repeating Things 2
 language: R
-exercises: ['Basic For Loops', 'Size Estimates By Name Loop','Multi-file Analysis', 'Check That Your Code Runs', 'DNA or RNA Iteration', 'Cocili Data Exploration', 'Length of Floods']
-points: [25, 25, 40, 10, 'Challenge - optional', 'Challenge - optional', 'Challenge - optional']
+exercises: ['Basic For Loops', 'Size Estimates By Name Loop','Multi-file Analysis', 'DNA or RNA Iteration', 'Check That Your Code Runs', 'Cocili Data Exploration', 'Length of Floods']
+points: [20, 20, 20, 30, 10, 'Challenge - optional', 'Challenge - optional']
 ---
 
 ### Learning Objectives

exercises/Loops-basic-for-loops-R.md

@@ -40,7 +40,13 @@ for (__ in 1:length(________)){
 areas
 ```
 
-5\. Complete the code below to calculate an area for each pair of `lengths` and `widths`, store the areas in a vector, and after they are all calculated print them out: 
+5\. Write a for loop that loops over the following vector and stores the height in meters (height_m = height_ft / 3.28) in a new vector. After the for loop make sure to display the vector to the console by running the vectors name on its own line.
+
+```r
+height_ft <- c(5.1, 6.3, 5.7, 5.4)
+```
+
+6\. Complete the code below to calculate an area for each pair of `lengths` and `widths`, store the areas in a vector, and after they are all calculated print them out: 
 
 ```r
 lengths = c(1.1, 2.2, 1.6)

exercises/Making-choices-dna-or-rna-iteration-R.md

@@ -14,14 +14,15 @@ sequence the only way to tell the difference between DNA and RNA is that
 RNA has the base Uracil (`"u"`) instead of the base Thymine (`"t"`). Have the
 function return one of three outputs: `"DNA"`, `"RNA"`, or `"UNKNOWN"`.
 
-1. Use the function and a `for` loop to print the type of the sequences in the
-following list.
-2. Use the function and `sapply` to print the type of the sequences in the
-following list.
+Copy and paste the following sequence data into your script:
 
 ```
 sequences = c("ttgaatgccttacaactgatcattacacaggcggcatgaagcaaaaatatactgtgaaccaatgcaggcg", "gauuauuccccacaaagggagugggauuaggagcugcaucauuuacaagagcagaauguuucaaaugcau", "gaaagcaagaaaaggcaggcgaggaagggaagaagggggggaaacc", "guuuccuacaguauuugaugagaaugagaguuuacuccuggaagauaauauuagaauguuuacaacugcaccugaucagguggauaaggaagaugaagacu", "gauaaggaagaugaagacuuucaggaaucuaauaaaaugcacuccaugaauggauucauguaugggaaucagccggguc")
 ```
 
+1. Use the function you wrote and a `for` loop to create a vector of sequence types for the values in `sequences`
+2. Use the function and a `for` loop to create a data frame that includes a column of sequences and a column of their types
+3. Use the function and `sapply` to create a vector of sequence types for the values in `sequences`
+
 *Optional: For a little extra challenge make your function work with both upper
 and lower case letters, or even strings with mixed capitalization*