Skip to content
New issue

Have a question about this project? Sign up for a free GitHub account to open an issue and contact its maintainers and the community.

Sign up for GitHub

By clicking “Sign up for GitHub”, you agree to our terms of service and privacy statement. We’ll occasionally send you account related emails.

Already on GitHub? Sign in to your account

Add a dplyr verions to DNA orRNA iteration #1097

Merged
merged 1 commit into from
Oct 31, 2024
Merged

Add a dplyr verions to DNA orRNA iteration #1097

Changes from all commits
Commits
Show all changes
1 commit
Select commit
File filter

Filter by extension

Filter by extension
Conversations
Failed to load comments.
Loading
Jump to
Jump to file
Failed to load files.
Loading
Diff view
Diff view
1 change: 1 addition & 0 deletions exercises/Making-choices-dna-or-rna-iteration-R.md
View file
Open in desktop
Original file line number Diff line number Diff line change
Expand Up @@ -23,6 +23,7 @@ sequences = c("ttgaatgccttacaactgatcattacacaggcggcatgaagcaaaaatatactgtgaaccaatgc
1. Use the function you wrote and a `for` loop to create a vector of sequence types for the values in `sequences`
2. Use the function and a `for` loop to create a data frame that includes a column of sequences and a column of their types
3. Use the function and `sapply` to create a vector of sequence types for the values in `sequences`
4. Use the function, and `dplyr` to create a data frame that inclues a column of sequences and a column of their types

*Optional: For a little extra challenge make your function work with both upper
and lower case letters, or even strings with mixed capitalization*
Loading