The goal of this program is to take a series of single nucleotide polymprphisms (snps) associated with short sequence reads and determine their exact base pair position in the context of a larger genome. When working with reduced representation sequencing, the data produced will include short DNA sequences (50-200bp in length) and a series of snps associated with these sequences. The problem with these short reads is a lack of context. snp-placer is designed to help provide this context for snps identified in short sequence reads.
By taking a list of snps and their location in short sequence reads (in the correct format) and alignment information (in the form of a .sam file) snp-placer will give the exact base pair position of the snps in the whole genome sequence. It does this by taking the alignment information and adjusting the basepair position of the snp to account for things such as insertions, deletions and reverse alignments. This is important information for comparative study of snps identified in different studies/techniques as it orients the snps relative to a common reference.
This can also be useful if you need more surrounding sequence information then provided by the origninal short sequence reads. By placing the snp in the correct location on the genome, you are able to pull an exact amount of flanking sequence from either side of the snp for further analysis. This can help in compartive genome analyses (obtaining inputs for BLAST) or for things like designing genotyping arrays, were an exact amount of flanking sequence is needed on either side of the snp.
The program requires two inputs:
- A list of short sequence reads with the information formatted as follows:
- The name associated with the snp
- The alleles involved in the polymorphism (separated by a slash /)
- The base pair position of the snp. The first bp in the string is position 1.
- The DNA sequence
SNP Polymorphism bp Sequence
CMN1211 G/T 24 TGCATATGGCTCATCACAAATACGCAGAAAAAATGTTGCAGGTGGAGCATCACATGCA
CMN8988 A/C 51 TGCATATGGCTCTCCTATTCTTTGCCCAGTCATATTCAAGGTTAGAACTCATTTTCTAGGGTTC
Where for the sequence 'CMN1211' there is a G at the 24th base pair of the sequence, and T is the alternate allele at this location.
- A .sam file as input, aligning the short sequence reads from 1. to a genome (or simply larger contigs). The .sam file(s) can be generated using samtools or any equivalent workflow of the user's choice that generates alignment data in the .sam format.
See the folder example_data for example input files.
The program is written in python3.6 and utilizes pandas, which can be obtained by typing the following into the command line: pip install pandas
To use the program, you first filter the input .sam file using filter_sam_file.py and then pass the output(s) from the filter step to place_snps.py along with the short sequence read information files.
You can conduct an initial filtering of the .sam file, splitting the file into sequences that align to one location (default output name one_location_alignments.sam) and sequences that align to two+ locations (default output name multiple_location_alignments.sam). This is done because it is logical to treat these cases differently. Short sequence reads aligning to 2+ inherently introduce uncertainty into the exact bp location of snps, so these should be used with caution.
filter_sam.py can be run directly from the command line using the follwing syntax
python filter_sam.py input_sam_file.sam
The input_sam_file.sam data will be filtered and data is sent to the one location (one_location_alignments.sam) and two+ locations (multiple_location_alignments.sam) output files. Sequences aligning to no locations are discarded.
The output file names can be changed using the -p flag to indicate the one location output filename and the -s flag to indicate the two+ locations output filename. For example:
python filter_sam.py input_sam_file.sam -p example_name_primary.sam -s example_name_secondary.sam
This takes a list of short sequence reads and a filtered .sam file and accurately places the snps from the short reads in the context of the larger genome (the .sam file's subject sequences, the short reads are the .sam file's query sequences). Required inputs are one or more .sam files, one or more snp information files in .txt format.
python place_snps.py -s example_name_primary.sam -p short_snp_seqs.txt
The output is in .vcf format. Default output name is placed_snps.vcf, change this with the -o flag.
python place_snps.py -s example_name_primary.sam -p short_snp_seqs.txt -o example_output_name.vcf
Multiple files can be passed after the two input flags
python place_snps.py -s example_name_primary_a.sam example_name_primary_b.sam -p short_snp_seqs_a.txt short_snp_seqs_b.txt