Skip to content

Commit

Permalink
update GNAP to use updated schema - (InfoControllerApi updated to ret…
Browse files Browse the repository at this point in the history 
…urn multiple versions such as GN server, database, VEP...) (#236)

Version outputted will be GN Server Version
Updated header in expected outputs for integration tests
Updated unit tests to reflect actual output from GN (these tests are brittle and unrelated to the version change, will most likely break down the line)

Co-authored-by: Avery Wang <[email protected]>
  • Loading branch information
@averyniceday
averyniceday and Avery Wang authored Dec 12, 2022
1 parent 90a1e9f commit a8dfabf
Show file tree
Hide file tree
Showing 16 changed files with 37 additions and 37 deletions.
2 changes: 1 addition & 1 deletion annotationPipeline/src/test/resources/expected/corner_cases.mskcc.txt
View file
Original file line number Diff line number Diff line change
@@ -1,4 +1,4 @@
#genome_nexus_version: 0-unknown-version-SNAPSHOT
#genome_nexus_version: 1.0.2
#isoform: mskcc
Hugo_Symbol Entrez_Gene_Id Center NCBI_Build Chromosome Start_Position End_Position Strand Consequence Variant_Classification Variant_Type Reference_Allele Tumor_Seq_Allele1 Tumor_Seq_Allele2 dbSNP_RS dbSNP_Val_Status Tumor_Sample_Barcode Matched_Norm_Sample_Barcode Match_Norm_Seq_Allele1 Match_Norm_Seq_Allele2 Tumor_Validation_Allele1 Tumor_Validation_Allele2 Match_Norm_Validation_Allele1 Match_Norm_Validation_Allele2 Verification_Status Validation_Status Mutation_Status Sequencing_Phase Sequence_Source Validation_Method Score BAM_File Sequencer t_ref_count t_alt_count n_ref_count n_alt_count HGVSc HGVSp HGVSp_Short Transcript_ID RefSeq Protein_position Codons Exon_Number Annotation_Status
MET 4233 GRCh37 7 116411872 116411900 + splice_region_variant,intron_variant Splice_Region DEL TAACAAGCTCTTTCTTTCTCTCTGTTTTA - - ENST00000397752.3:c.2888-31_2888-3del p.X963_splice ENST00000397752 NM_000245.2 963 SUCCESS
Expand Down
2 changes: 1 addition & 1 deletion annotationPipeline/src/test/resources/expected/corner_cases.two_tumor_seq_allele.mskcc.txt
View file
Original file line number Diff line number Diff line change
@@ -1,4 +1,4 @@
#genome_nexus_version: 0-unknown-version-SNAPSHOT
#genome_nexus_version: 1.0.2
#isoform: mskcc
Hugo_Symbol Entrez_Gene_Id Center NCBI_Build Chromosome Start_Position End_Position Strand Consequence Variant_Classification Variant_Type Reference_Allele Tumor_Seq_Allele1 Tumor_Seq_Allele2 dbSNP_RS dbSNP_Val_Status Tumor_Sample_Barcode Matched_Norm_Sample_Barcode Match_Norm_Seq_Allele1 Match_Norm_Seq_Allele2 Tumor_Validation_Allele1 Tumor_Validation_Allele2 Match_Norm_Validation_Allele1 Match_Norm_Validation_Allele2 Verification_Status Validation_Status Mutation_Status Sequencing_Phase Sequence_Source Validation_Method Score BAM_File Sequencer t_ref_count t_alt_count n_ref_count n_alt_count HGVSc HGVSp HGVSp_Short Transcript_ID RefSeq Protein_position Codons Exon_Number Annotation_Status
PCM1 5108 GRCh37 8 17796382 17796383 + frameshift_variant Frame_Shift_Ins INS - AAC A ENST00000325083.8:c.476dup p.Asn159LysfsTer14 p.N159Kfs*14 ENST00000325083 NM_006197.3 159 aac/aaAc 5/39 SUCCESS
Expand Down
2 changes: 1 addition & 1 deletion annotationPipeline/src/test/resources/expected/corner_cases.two_tumor_seq_allele.uniprot.txt
View file
Original file line number Diff line number Diff line change
@@ -1,4 +1,4 @@
#genome_nexus_version: 0-unknown-version-SNAPSHOT
#genome_nexus_version: 1.0.2
#isoform: uniprot
Hugo_Symbol Entrez_Gene_Id Center NCBI_Build Chromosome Start_Position End_Position Strand Consequence Variant_Classification Variant_Type Reference_Allele Tumor_Seq_Allele1 Tumor_Seq_Allele2 dbSNP_RS dbSNP_Val_Status Tumor_Sample_Barcode Matched_Norm_Sample_Barcode Match_Norm_Seq_Allele1 Match_Norm_Seq_Allele2 Tumor_Validation_Allele1 Tumor_Validation_Allele2 Match_Norm_Validation_Allele1 Match_Norm_Validation_Allele2 Verification_Status Validation_Status Mutation_Status Sequencing_Phase Sequence_Source Validation_Method Score BAM_File Sequencer t_ref_count t_alt_count n_ref_count n_alt_count HGVSc HGVSp HGVSp_Short Transcript_ID RefSeq Protein_position Codons Exon_Number Annotation_Status
PCM1 5108 GRCh37 8 17796382 17796383 + frameshift_variant Frame_Shift_Ins INS - AAC A ENST00000325083.8:c.476dup p.Asn159LysfsTer14 p.N159Kfs*14 ENST00000325083 NM_006197.3 159 aac/aaAc 5/39 SUCCESS
Expand Down
2 changes: 1 addition & 1 deletion annotationPipeline/src/test/resources/expected/corner_cases.uniprot.txt
View file
Original file line number Diff line number Diff line change
@@ -1,4 +1,4 @@
#genome_nexus_version: 0-unknown-version-SNAPSHOT
#genome_nexus_version: 1.0.2
#isoform: uniprot
Hugo_Symbol Entrez_Gene_Id Center NCBI_Build Chromosome Start_Position End_Position Strand Consequence Variant_Classification Variant_Type Reference_Allele Tumor_Seq_Allele1 Tumor_Seq_Allele2 dbSNP_RS dbSNP_Val_Status Tumor_Sample_Barcode Matched_Norm_Sample_Barcode Match_Norm_Seq_Allele1 Match_Norm_Seq_Allele2 Tumor_Validation_Allele1 Tumor_Validation_Allele2 Match_Norm_Validation_Allele1 Match_Norm_Validation_Allele2 Verification_Status Validation_Status Mutation_Status Sequencing_Phase Sequence_Source Validation_Method Score BAM_File Sequencer t_ref_count t_alt_count n_ref_count n_alt_count HGVSc HGVSp HGVSp_Short Transcript_ID RefSeq Protein_position Codons Exon_Number Annotation_Status
MET 4233 GRCh37 7 116411872 116411900 + splice_region_variant,intron_variant Splice_Region DEL TAACAAGCTCTTTCTTTCTCTCTGTTTTA - - ENST00000397752.3:c.2888-31_2888-3del p.X963_splice ENST00000397752 NM_000245.2 963 SUCCESS
Expand Down
34 changes: 17 additions & 17 deletions annotationPipeline/src/test/resources/expected/data_mutations_extended_100.mskcc.txt
View file

Large diffs are not rendered by default.

4 changes: 2 additions & 2 deletions ...ne/src/test/resources/expected/data_mutations_extended_100.uniprot.nucleotide_context.txt
View file
Original file line number Diff line number Diff line change
@@ -1,4 +1,4 @@
#genome_nexus_version: 0-unknown-version-SNAPSHOT
#genome_nexus_version: 1.0.2
#isoform: uniprot
Hugo_Symbol Entrez_Gene_Id Center NCBI_Build Chromosome Start_Position End_Position Strand Consequence Variant_Classification Variant_Type Reference_Allele Tumor_Seq_Allele1 Tumor_Seq_Allele2 dbSNP_RS dbSNP_Val_Status Tumor_Sample_Barcode Matched_Norm_Sample_Barcode Match_Norm_Seq_Allele1 Match_Norm_Seq_Allele2 Tumor_Validation_Allele1 Tumor_Validation_Allele2 Match_Norm_Validation_Allele1 Match_Norm_Validation_Allele2 Verification_Status Validation_Status Mutation_Status Sequencing_Phase Sequence_Source Validation_Method Score BAM_File Sequencer t_ref_count t_alt_count n_ref_count n_alt_count HGVSc HGVSp HGVSp_Short Transcript_ID RefSeq Protein_position Codons Exon_Number Ref_Tri Var_Tri Annotation_Status
SPEN GRCh37 1 16265908 16265908 + missense_variant Missense_Mutation SNP A A T P-0000004-T01-IM3 400 73 ENST00000375759.3:c.10981A>T p.Ile3661Phe p.I3661F ENST00000375759 NM_015001.2 3661 Att/Ttt 15/15 CAT CTT SUCCESS
Expand Down Expand Up @@ -91,7 +91,7 @@ FAT1 GRCh37 4 187539969 187539969 + missense_variant Missense_Mutation SNP C C
SMARCA4 GRCh37 19 11144146 11144146 + missense_variant Missense_Mutation SNP C C G P-0000061-T01-IM3 205 81 ENST00000344626.4:c.3727C>G p.Arg1243Gly p.R1243G ENST00000344626 NM_003072.3 1243 Cgg/Ggg 26/35 GCG GGG SUCCESS
TP53 GRCh37 17 7577539 7577539 + missense_variant Missense_Mutation SNP G G A rs121912651 P-0000062-T01-IM3 265 581 ENST00000269305.4:c.742C>T p.Arg248Trp p.R248W ENST00000269305 NM_001126112.2 248 Cgg/Tgg 7/11 CGG CAG SUCCESS
EZH2 GRCh37 7 148523605 148523605 + missense_variant Missense_Mutation SNP G G A rs587778304 P-0000062-T01-IM3 980 54 ENST00000460911.1:c.848C>T p.Thr283Met p.T283M ENST00000460911 283 aCg/aTg 8/20 CGT CAT SUCCESS
MDM2 GRCh37 12 69222656 69222656 + missense_variant Missense_Mutation SNP A A T P-0000062-T01-IM3 1485 328 ENST00000462284.1:c.629A>T p.Glu210Val p.E210V ENST00000462284 NM_002392.5 210 gAg/gTg 8/11 GAG GTG SUCCESS
MDM2 GRCh37 12 69222656 69222656 + missense_variant Missense_Mutation SNP A A T P-0000062-T01-IM3 1485 328 ENST00000258149.5:c.446A>T p.Glu149Val p.E149V ENST00000258149 NM_001145339.2 149 gAg/gTg 6/9 GAG GTG SUCCESS
IGF1R GRCh37 15 99486153 99486153 + missense_variant,splice_region_variant Missense_Mutation SNP T T G P-0000062-T01-IM3 927 69 ENST00000268035.6:c.3459T>G p.Asp1153Glu p.D1153E ENST00000268035 NM_000875.3 1153 gaT/gaG 19/21 ATT AGT SUCCESS
KEAP1 GRCh37 19 10602303 10602303 + missense_variant Missense_Mutation SNP G G C rs754011905 P-0000062-T01-IM3 807 422 ENST00000171111.5:c.1275C>G p.Ile425Met p.I425M ENST00000171111 NM_203500.1 425 atC/atG 3/6 AGA ACA SUCCESS
KDM5C GRCh37 X 53223386 53223386 + missense_variant Missense_Mutation SNP G G C P-0000062-T01-IM3 514 151 ENST00000375401.3:c.3973C>G p.Pro1325Ala p.P1325A ENST00000375401 NM_004187.3 1325 Cct/Gct 23/26 GGA GCA SUCCESS
Expand Down
4 changes: 2 additions & 2 deletions annotationPipeline/src/test/resources/expected/data_mutations_extended_100.uniprot.txt
View file
Original file line number Diff line number Diff line change
@@ -1,4 +1,4 @@
#genome_nexus_version: 0-unknown-version-SNAPSHOT
#genome_nexus_version: 1.0.2
#isoform: uniprot
Hugo_Symbol Entrez_Gene_Id Center NCBI_Build Chromosome Start_Position End_Position Strand Consequence Variant_Classification Variant_Type Reference_Allele Tumor_Seq_Allele1 Tumor_Seq_Allele2 dbSNP_RS dbSNP_Val_Status Tumor_Sample_Barcode Matched_Norm_Sample_Barcode Match_Norm_Seq_Allele1 Match_Norm_Seq_Allele2 Tumor_Validation_Allele1 Tumor_Validation_Allele2 Match_Norm_Validation_Allele1 Match_Norm_Validation_Allele2 Verification_Status Validation_Status Mutation_Status Sequencing_Phase Sequence_Source Validation_Method Score BAM_File Sequencer t_ref_count t_alt_count n_ref_count n_alt_count HGVSc HGVSp HGVSp_Short Transcript_ID RefSeq Protein_position Codons Exon_Number Annotation_Status
SPEN GRCh37 1 16265908 16265908 + missense_variant Missense_Mutation SNP A A T P-0000004-T01-IM3 400 73 ENST00000375759.3:c.10981A>T p.Ile3661Phe p.I3661F ENST00000375759 NM_015001.2 3661 Att/Ttt 15/15 SUCCESS
Expand Down Expand Up @@ -91,7 +91,7 @@ FAT1 GRCh37 4 187539969 187539969 + missense_variant Missense_Mutation SNP C C
SMARCA4 GRCh37 19 11144146 11144146 + missense_variant Missense_Mutation SNP C C G P-0000061-T01-IM3 205 81 ENST00000344626.4:c.3727C>G p.Arg1243Gly p.R1243G ENST00000344626 NM_003072.3 1243 Cgg/Ggg 26/35 SUCCESS
TP53 GRCh37 17 7577539 7577539 + missense_variant Missense_Mutation SNP G G A rs121912651 P-0000062-T01-IM3 265 581 ENST00000269305.4:c.742C>T p.Arg248Trp p.R248W ENST00000269305 NM_001126112.2 248 Cgg/Tgg 7/11 SUCCESS
EZH2 GRCh37 7 148523605 148523605 + missense_variant Missense_Mutation SNP G G A rs587778304 P-0000062-T01-IM3 980 54 ENST00000460911.1:c.848C>T p.Thr283Met p.T283M ENST00000460911 283 aCg/aTg 8/20 SUCCESS
MDM2 GRCh37 12 69222656 69222656 + missense_variant Missense_Mutation SNP A A T P-0000062-T01-IM3 1485 328 ENST00000462284.1:c.629A>T p.Glu210Val p.E210V ENST00000462284 NM_002392.5 210 gAg/gTg 8/11 SUCCESS
MDM2 GRCh37 12 69222656 69222656 + missense_variant Missense_Mutation SNP A A T P-0000062-T01-IM3 1485 328 ENST00000258149.5:c.446A>T p.Glu149Val p.E149V ENST00000258149 NM_001145339.2 149 gAg/gTg 6/9 SUCCESS
IGF1R GRCh37 15 99486153 99486153 + missense_variant,splice_region_variant Missense_Mutation SNP T T G P-0000062-T01-IM3 927 69 ENST00000268035.6:c.3459T>G p.Asp1153Glu p.D1153E ENST00000268035 NM_000875.3 1153 gaT/gaG 19/21 SUCCESS
KEAP1 GRCh37 19 10602303 10602303 + missense_variant Missense_Mutation SNP G G C rs754011905 P-0000062-T01-IM3 807 422 ENST00000171111.5:c.1275C>G p.Ile425Met p.I425M ENST00000171111 NM_203500.1 425 atC/atG 3/6 SUCCESS
KDM5C GRCh37 X 53223386 53223386 + missense_variant Missense_Mutation SNP G G C P-0000062-T01-IM3 514 151 ENST00000375401.3:c.3973C>G p.Pro1325Ala p.P1325A ENST00000375401 NM_004187.3 1325 Cct/Gct 23/26 SUCCESS
Expand Down
2 changes: 1 addition & 1 deletion annotationPipeline/src/test/resources/expected/minimal_example.uniprot.txt
View file
Original file line number Diff line number Diff line change
@@ -1,4 +1,4 @@
#genome_nexus_version: 0-unknown-version-SNAPSHOT
#genome_nexus_version: 1.0.2
#isoform: uniprot
Hugo_Symbol Entrez_Gene_Id Center NCBI_Build Chromosome Start_Position End_Position Strand Consequence Variant_Classification Variant_Type Reference_Allele Tumor_Seq_Allele1 Tumor_Seq_Allele2 dbSNP_RS dbSNP_Val_Status Tumor_Sample_Barcode Matched_Norm_Sample_Barcode Match_Norm_Seq_Allele1 Match_Norm_Seq_Allele2 Tumor_Validation_Allele1 Tumor_Validation_Allele2 Match_Norm_Validation_Allele1 Match_Norm_Validation_Allele2 Verification_Status Validation_Status Mutation_Status Sequencing_Phase Sequence_Source Validation_Method Score BAM_File Sequencer t_ref_count t_alt_count n_ref_count n_alt_count HGVSc HGVSp HGVSp_Short Transcript_ID RefSeq Protein_position Codons Exon_Number Annotation_Status
PIK3CA 5290 GRCh37 3 178916927 178916939 + protein_altering_variant In_Frame_Del DEL TAGGCAACCGTGA G G ENST00000263967.3:c.314_326delinsG p.Val105_Glu109delinsGly p.V105_E109delinsG ENST00000263967 NM_006218.2 105 gTAGGCAACCGTGAa/gGa 2/21 SUCCESS
Expand Down
4 changes: 2 additions & 2 deletions annotationPipeline/src/test/resources/expected/my_variant_info_corner_cases.uniprot.txt
View file
Original file line number Diff line number Diff line change
@@ -1,4 +1,4 @@
#genome_nexus_version: 0-unknown-version-SNAPSHOT
#genome_nexus_version: 1.0.2
#isoform: uniprot
Hugo_Symbol Entrez_Gene_Id Center NCBI_Build Chromosome Start_Position End_Position Strand Consequence Variant_Classification Variant_Type Reference_Allele Tumor_Seq_Allele1 Tumor_Seq_Allele2 dbSNP_RS dbSNP_Val_Status Tumor_Sample_Barcode Matched_Norm_Sample_Barcode Match_Norm_Seq_Allele1 Match_Norm_Seq_Allele2 Tumor_Validation_Allele1 Tumor_Validation_Allele2 Match_Norm_Validation_Allele1 Match_Norm_Validation_Allele2 Verification_Status Validation_Status Mutation_Status Sequencing_Phase Sequence_Source Validation_Method Score BAM_File Sequencer t_ref_count t_alt_count n_ref_count n_alt_count HGVSc HGVSp HGVSp_Short Transcript_ID RefSeq Protein_position Codons Exon_Number gnomAD_AF gnomAD_AFR_AF gnomAD_AMR_AF gnomAD_ASJ_AF gnomAD_EAS_AF gnomAD_FIN_AF gnomAD_NFE_AF gnomAD_OTH_AF gnomAD_SAS_AF Annotation_Status
BARD1 580 GRCh37 2 215645503 215645523 + inframe_deletion In_Frame_Del DEL TGGTGAAGAACATTCAGGCAA - - rs28997575 ENST00000260947.4:c.1075_1095del p.Leu359_Pro365del p.L359_P365del ENST00000260947 NM_000465.2 359 TTGCCTGAATGTTCTTCACCA/- 4/11 0.0288928 0.0431947 0.0336575 0.012004 0.0438969 0.00355757 0.0178879 0.0324421 0.0705371 SUCCESS
BARD1 580 GRCh37 2 215645503 215645523 + inframe_deletion In_Frame_Del DEL TGGTGAAGAACATTCAGGCAA - - rs28997575 ENST00000260947.4:c.1075_1095del p.Leu359_Pro365del p.L359_P365del ENST00000260947 NM_000465.2 359 TTGCCTGAATGTTCTTCACCA/- 4/11 SUCCESS
2 changes: 1 addition & 1 deletion annotationPipeline/src/test/resources/expected/test_output_format_extended.expected.txt
View file
Original file line number Diff line number Diff line change
@@ -1,4 +1,4 @@
#genome_nexus_version: 0-unknown-version-SNAPSHOT
#genome_nexus_version: 1.0.2
#isoform: uniprot
Hugo_Symbol Entrez_Gene_Id Center NCBI_Build Chromosome Start_Position End_Position Strand Variant_Classification Variant_Type Reference_Allele Tumor_Seq_Allele1 Tumor_Seq_Allele2 dbSNP_RS dbSNP_Val_Status Tumor_Sample_Barcode Matched_Norm_Sample_Barcode Match_Norm_Seq_Allele1 Match_Norm_Seq_Allele2 Tumor_Validation_Allele1 Tumor_Validation_Allele2 Match_Norm_Validation_Allele1 Match_Norm_Validation_Allele2 Verification_Status Validation_Status Mutation_Status Sequencing_Phase Sequence_Source Validation_Method Score BAM_File Sequencer HGVSp_Short t_alt_count t_ref_count n_alt_count n_ref_count A B C Codons Consequence D Exon_Number HGVSc HGVSp Protein_position RefSeq Transcript_ID Annotation_Status
PIK3CA 5290 GRCh37 3 178916927 178916939 + In_Frame_Del DEL TAGGCAACCGTGA G G p.V105_E109delinsG gTAGGCAACCGTGAa/gGa protein_altering_variant 2/21 ENST00000263967.3:c.314_326delinsG p.Val105_Glu109delinsGly 105 NM_006218.2 ENST00000263967 SUCCESS
Expand Down
2 changes: 1 addition & 1 deletion annotationPipeline/src/test/resources/expected/test_output_format_minimal.expected.txt
View file
Original file line number Diff line number Diff line change
@@ -1,4 +1,4 @@
#genome_nexus_version: 0-unknown-version-SNAPSHOT
#genome_nexus_version: 1.0.2
#isoform: uniprot
Chromosome Start_Position End_Position Reference_Allele Tumor_Seq_Allele1 BAM_File Center Codons Consequence Entrez_Gene_Id Exon_Number HGVSc HGVSp HGVSp_Short Hugo_Symbol Match_Norm_Seq_Allele1 Match_Norm_Seq_Allele2 Match_Norm_Validation_Allele1 Match_Norm_Validation_Allele2 Matched_Norm_Sample_Barcode Mutation_Status NCBI_Build Protein_position RefSeq Score Sequence_Source Sequencer Sequencing_Phase Strand Transcript_ID Tumor_Sample_Barcode Tumor_Seq_Allele2 Tumor_Validation_Allele1 Tumor_Validation_Allele2 Validation_Method Validation_Status Variant_Classification Variant_Type Verification_Status dbSNP_RS dbSNP_Val_Status n_alt_count n_ref_count t_alt_count t_ref_count Annotation_Status
3 178916927 178916939 TAGGCAACCGTGA G gTAGGCAACCGTGAa/gGa protein_altering_variant 5290 2/21 ENST00000263967.3:c.314_326delinsG p.Val105_Glu109delinsGly p.V105_E109delinsG PIK3CA GRCh37 105 NM_006218.2 + ENST00000263967 G In_Frame_Del DEL SUCCESS
Expand Down
2 changes: 1 addition & 1 deletion ...ationPipeline/src/test/resources/expected/test_output_format_with_formatFile.expected.txt
View file
Original file line number Diff line number Diff line change
@@ -1,4 +1,4 @@
#genome_nexus_version: 0-unknown-version-SNAPSHOT
#genome_nexus_version: 1.0.2
#isoform: uniprot
Hugo_Symbol Entrez_Gene_Id Center NCBI_Build Chromosome Annotation_Status
SPEN 23013 GRCh37 1 SUCCESS
Expand Down
2 changes: 1 addition & 1 deletion annotationPipeline/src/test/resources/expected/vcf2maf_tests.mskcc.txt
View file
Original file line number Diff line number Diff line change
@@ -1,4 +1,4 @@
#genome_nexus_version: 0-unknown-version-SNAPSHOT
#genome_nexus_version: 1.0.2
#isoform: mskcc
#version 2.4
Hugo_Symbol Entrez_Gene_Id Center NCBI_Build Chromosome Start_Position End_Position Strand Consequence Variant_Classification Variant_Type Reference_Allele Tumor_Seq_Allele1 Tumor_Seq_Allele2 dbSNP_RS dbSNP_Val_Status Tumor_Sample_Barcode Matched_Norm_Sample_Barcode Match_Norm_Seq_Allele1 Match_Norm_Seq_Allele2 Tumor_Validation_Allele1 Tumor_Validation_Allele2 Match_Norm_Validation_Allele1 Match_Norm_Validation_Allele2 Verification_Status Validation_Status Mutation_Status Sequencing_Phase Sequence_Source Validation_Method Score BAM_File Sequencer t_ref_count t_alt_count n_ref_count n_alt_count HGVSc HGVSp HGVSp_Short Transcript_ID RefSeq Protein_position Codons Exon_Number n_depth t_depth Annotation_Status
Expand Down
2 changes: 1 addition & 1 deletion annotationPipeline/src/test/resources/expected/vcf2maf_tests.uniprot.txt
View file
Original file line number Diff line number Diff line change
@@ -1,4 +1,4 @@
#genome_nexus_version: 0-unknown-version-SNAPSHOT
#genome_nexus_version: 1.0.2
#isoform: uniprot
#version 2.4
Hugo_Symbol Entrez_Gene_Id Center NCBI_Build Chromosome Start_Position End_Position Strand Consequence Variant_Classification Variant_Type Reference_Allele Tumor_Seq_Allele1 Tumor_Seq_Allele2 dbSNP_RS dbSNP_Val_Status Tumor_Sample_Barcode Matched_Norm_Sample_Barcode Match_Norm_Seq_Allele1 Match_Norm_Seq_Allele2 Tumor_Validation_Allele1 Tumor_Validation_Allele2 Match_Norm_Validation_Allele1 Match_Norm_Validation_Allele2 Verification_Status Validation_Status Mutation_Status Sequencing_Phase Sequence_Source Validation_Method Score BAM_File Sequencer t_ref_count t_alt_count n_ref_count n_alt_count HGVSc HGVSp HGVSp_Short Transcript_ID RefSeq Protein_position Codons Exon_Number n_depth t_depth Annotation_Status
Expand Down
4 changes: 2 additions & 2 deletions annotator/src/main/java/org/cbioportal/annotator/internal/GenomeNexusImpl.java
View file
Original file line number Diff line number Diff line change
Expand Up @@ -192,8 +192,8 @@ public List<AnnotatedRecord> annotateRecordsUsingGET(AnnotationSummaryStatistics
public String getVersion() {
InfoControllerApi infoApiClient = new InfoControllerApi();
try {
Version result = infoApiClient.fetchVersionGET();
return result.getVersion();
AggregateSourceInfo result = infoApiClient.fetchVersionGET();
return result.getGenomeNexus().getServer().getVersion();
} catch (ApiException e) {
LOG.error("Exception when calling InfoControllerApi#fetchVersionGET, genome nexus version is unknown", e);
}
Expand Down
4 changes: 2 additions & 2 deletions pom.xml
View file
Original file line number Diff line number Diff line change
Expand Up @@ -103,12 +103,12 @@
<dependency>
<groupId>com.github.genome-nexus.genome-nexus-java-api-client</groupId>
<artifactId>genomeNexusPublicApiClient</artifactId>
<version>600501017ef64be14cfb36679babec30da9200ca</version>
<version>59f677151e77710be41ff07ac92969d383287068</version>
</dependency>
<dependency>
<groupId>com.github.genome-nexus.genome-nexus-java-api-client</groupId>
<artifactId>genomeNexusInternalApiClient</artifactId>
<version>600501017ef64be14cfb36679babec30da9200ca</version>
<version>59f677151e77710be41ff07ac92969d383287068</version>
</dependency>
<dependency>
<groupId>org.mockito</groupId>
Expand Down

0 comments on commit a8dfabf

Please sign in to comment.