Lepto in silico PCR

Requirements

Create conda environment and install packages:

conda create -n genomedl
conda activate genomedl
mamba install ncbi-genome-download ispcr

Usage

Bash files were ran on UGE using qsub command:

1. Download all 769 refseq files, make filenames readable, and ungzip.

qsub fetch_genomes.sh

2. Create new folder in same directory as the from_NCBI directory.

mkdir primers

3. Create file primers.tab with primer sequences and place into primers directory. Make sure spaces are tabs.

echo "LeptoPrimer    GAGTAACACGTGGGTAATCTTCCT        TTTACCCCACCAACTAGCTAATC" > primers.tab

4. Find primers from genomes.

qsub find_primers.sh

5. Concatenate forward and reverse primers by using concat_files function in python script.

6. Run mafft on concatenated files.

qsub mafft.sh

7. Analyze genome and save to file:

python3 analyze_lepto_genome.py

8. Check lepto_in_silico.xlsx for finished analysis.

Notes

The analyze_lepto_genome.py script was written where speed was key. Time was taken afterwards to add comments, show some data, and fix a few errors in the analyze_lepto_genomes.ipynb.

The word 'qsub' is used to send scripts to the HPC (UGE). This can be substituted with 'bash' to run locally.