Update seqkit to version 2.9.0

[heuermh]

Second part of #7314

PR checklist

Closes #XXX

• This comment contains a description of changes (with reason).
• If you've fixed a bug or added code that should be tested, add tests!
• If you've added a new tool - have you followed the module conventions in the contribution docs
• If necessary, include test data in your PR.
• Remove all TODO statements.
• Emit the versions.yml file.
• Follow the naming conventions.
• Follow the parameters requirements.
• Follow the input/output options guidelines.
• Add a resource label
• Use BioConda and BioContainers if possible to fulfil software requirements.
• Ensure that the test works with either Docker / Singularity. Conda CI tests can be quite flaky:
  • For modules:
    • nf-core modules test <MODULE> --profile docker
    • nf-core modules test <MODULE> --profile singularity
    • nf-core modules test <MODULE> --profile conda
  • For subworkflows:
    • nf-core subworkflows test <SUBWORKFLOW> --profile docker
    • nf-core subworkflows test <SUBWORKFLOW> --profile singularity
    • nf-core subworkflows test <SUBWORKFLOW> --profile conda

[heuermh]

Why is nf-test running (and failing) against modules not touched by this pull request?

[SPPearce]

Why is nf-test running (and failing) against modules not touched by this pull request?

Generally either because they use SEQKIT modules to setup their tests, or they are subworkflows that use SEQKIT.
In this case, you have two subworkflows, FASTA_EXPLORE_SEARCH_PLOT_TIDK and FASTQ_FIND_MIRNA_MIRDEEP2 that will need their snapshots updating, as their versions.yml have now changed.

[heuermh]

FASTQ_FIND_MIRNA_MIRDEEP2 doesn't run for me locally

$ nf-test test subworkflows/nf-core/fastq_find_mirna_mirdeep2/tests/main.nf.test --profile docker
...
    Status: Downloaded newer image for quay.io/biocontainers/mirdeep2:2.0.1.2--0
    qemu: uncaught target signal 11 (Segmentation fault) - core dumped
    .command.sh: line 7:    76 Segmentation fault      mapper.pl small_Clone1_N1.fasta -c -j
-k TCGTATGCCGTCTTCTGCTTGT -l 18 -m -v -p bowtie/genome -s small_Clone1_N1_collapsed.fa
-t small_Clone1_N1_reads_collapsed_vs_genome_genome.arf

Is it safe to just manually update version checksums in the snap file?

[SPPearce]

Yeah, if it runs on the CI that's sufficient

[heuermh]

Thank you, @SPPearce!