Merge pull request #3274 from antgonza/fix-docs

fix documentation
qiita-spots · Mar 25, 2023 · b8e151e · b8e151e
2 parents 2f351a7 + 405d244
commit b8e151e
Showing 1 changed file with 8 additions and 8 deletions.
diff --git a/qiita_pet/support_files/doc/source/processingdata/processing-recommendations.rst b/qiita_pet/support_files/doc/source/processingdata/processing-recommendations.rst
@@ -66,15 +66,15 @@ recommend that all sequence files go through adapter and host filtering within t
 subsequent meta-analyses. We currently provide the several options for your convenience. For each the `fastp` command is set to autodetect and remove universal adapter sequences (i.e., 'GATCGGAAGAGCACACGTCTGAACTCCAGTCAC' for R1 reads and 'GATCGGAAGAGCGTCGTGTAGGGAAAGGAGTGT' for R2 reads). We also provide the following host reference genomes for filtering against; each also filters against three phi x sequences (i.e., `HM753704.1 <https://www.ncbi.nlm.nih.gov/nuccore/HM753704.1/>`_, `JF719728.1 <https://www.ncbi.nlm.nih.gov/nuccore/JF719728.1>`_, `J02482.1 <https://www.ncbi.nlm.nih.gov/nuccore/J02482.1>`_):
 
 - auto-detect adapters and artifacts + phix filtering: This is a `deblur artifacts <https://github.com/biocore/deblur/blob/master/deblur/support_files/artifacts.fa>`_ reference, mainly for debugging and testing. Includes another adapter sequence (i.e., 'ATCTCGTATGCCGTCTTCTGC').
-- auto-detect adapters and **cheetah** + phix filtering. Includes cheetah (*Acinonyx jubatus*) reference `GCF_003709585.1 (Aci_jub_2) <https://www.ncbi.nlm.nih.gov/data-hub/genome/GCF_003709585.1/>`_. `Download link <https://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/003/709/585/GCF_003709585.1_Aci_jub_2/GCF_003709585.1_Aci_jub_2_genomic.fna.gz>`_
-- auto-detect adapters and **cow** + phix filtering. Includes cow (*Bos taurus*) reference `GCF_000003205.7 (Btau_5.0.1) <https://www.ncbi.nlm.nih.gov/data-hub/genome/GCF_000003205.7/>`_. `Download link <https://ftp.ncbi.nlm.nih.gov/genomes/all/GCA/000/003/205/GCA_000003205.6_Btau_5.0.1/GCA_000003205.6_Btau_5.0.1_genomic.fna.gz>`_
-- auto-detect adapters and **hamster** + phix filtering. Includes golden hamster (*Mesocricetus auratus*) reference `GCF_017639785.1 (BCM_Maur_2.0) <https://www.ncbi.nlm.nih.gov/data-hub/genome/GCF_017639785.1/>`_. `Download link <https://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/017/639/785/GCF_017639785.1_BCM_Maur_2.0/GCF_017639785.1_BCM_Maur_2.0_genomic.fna.gz>`_
-- auto-detect adapters and **horse** + phix filtering. Includes horse (*Equus caballus*) reference `GCF_000002305.2 (EquCab2.0) <https://www.ncbi.nlm.nih.gov/data-hub/genome/GCF_000002305.2/>`_. `Download link <https://ftp.ncbi.nlm.nih.gov/genomes/all/GCA/000/002/305/GCA_000002305.1_EquCab2.0/GCA_000002305.1_EquCab2.0_genomic.fna.gz>`_
+- auto-detect adapters and **cheetah** + phix filtering. Includes cheetah (*Acinonyx jubatus*) reference `GCF_003709585.1 (Aci_jub_2) <https://www.ncbi.nlm.nih.gov/data-hub/genome/GCF_003709585.1/>`_. `GCF_003709585.1 fna <https://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/003/709/585/GCF_003709585.1_Aci_jub_2/GCF_003709585.1_Aci_jub_2_genomic.fna.gz>`_
+- auto-detect adapters and **cow** + phix filtering. Includes cow (*Bos taurus*) reference `GCF_000003205.7 (Btau_5.0.1) <https://www.ncbi.nlm.nih.gov/data-hub/genome/GCF_000003205.7/>`_. `GCF_000003205.7 fna <https://ftp.ncbi.nlm.nih.gov/genomes/all/GCA/000/003/205/GCA_000003205.6_Btau_5.0.1/GCA_000003205.6_Btau_5.0.1_genomic.fna.gz>`_
+- auto-detect adapters and **hamster** + phix filtering. Includes golden hamster (*Mesocricetus auratus*) reference `GCF_017639785.1 (BCM_Maur_2.0) <https://www.ncbi.nlm.nih.gov/data-hub/genome/GCF_017639785.1/>`_. `GCF_017639785.1 fna <https://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/017/639/785/GCF_017639785.1_BCM_Maur_2.0/GCF_017639785.1_BCM_Maur_2.0_genomic.fna.gz>`_
+- auto-detect adapters and **horse** + phix filtering. Includes horse (*Equus caballus*) reference `GCF_000002305.2 (EquCab2.0) <https://www.ncbi.nlm.nih.gov/data-hub/genome/GCF_000002305.2/>`_. `GCF_000002305.2 fna <https://ftp.ncbi.nlm.nih.gov/genomes/all/GCA/000/002/305/GCA_000002305.1_EquCab2.0/GCA_000002305.1_EquCab2.0_genomic.fna.gz>`_
 - auto-detect adapters and **merge_genomes** + phix filtering. Includes the genomes of cheetah, cow, hamster, horse, mouse, pig, rabbit, and rat described here.
-- auto-detect adapters and **mouse** + phix filtering. Includes house mouse (*Mus musculus*) reference `GCF_000001635.27 (GRCm39) <https://www.ncbi.nlm.nih.gov/data-hub/genome/GCF_000001635.27/>`_. `Download link <https://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/001/635/GCF_000001635.27_GRCm39/GCF_000001635.27_GRCm39_genomic.fna.gz>`_
-- auto-detect adapters and **pig** + phix filtering. Includes pig (*Sus scrofa*) reference `GCF_000003025.6 (Sscrofa11.1) <https://www.ncbi.nlm.nih.gov/data-hub/genome/GCF_000003025.6/>`_. `Download link <https://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/003/025/GCF_000003025.6_Sscrofa11.1/GCF_000003025.6_Sscrofa11.1_genomic.fna.gz>`_
-- auto-detect adapters and **rabbit** + phix filtering. Includes rabbit (*Oryctolagus cuniculus*) reference `GCF_000003625.3 (OryCun2.0) <https://www.ncbi.nlm.nih.gov/data-hub/genome/GCF_000003625.3/>`_. `Download link <https://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/003/625/GCF_000003625.3_OryCun2.0/GCF_000003625.3_OryCun2.0_genomic.fna.gz>`_
-- auto-detect adapters and **rat** + phix filtering. Includes Norway rat (*Rattus norvegicus*) reference `GCF_000001895.5 (Rnor_6.0) <https://www.ncbi.nlm.nih.gov/data-hub/genome/GCF_000001895.5/>`_. `Download link <https://ftp.ncbi.nlm.nih.gov/genomes/all/GCA/000/001/895/GCA_000001895.4_Rnor_6.0/GCA_000001895.4_Rnor_6.0_genomic.fna.gz>`_
+- auto-detect adapters and **mouse** + phix filtering. Includes house mouse (*Mus musculus*) reference `GCF_000001635.27 (GRCm39) <https://www.ncbi.nlm.nih.gov/data-hub/genome/GCF_000001635.27/>`_. `GCF_000001635.27 fna <https://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/001/635/GCF_000001635.27_GRCm39/GCF_000001635.27_GRCm39_genomic.fna.gz>`_
+- auto-detect adapters and **pig** + phix filtering. Includes pig (*Sus scrofa*) reference `GCF_000003025.6 (Sscrofa11.1) <https://www.ncbi.nlm.nih.gov/data-hub/genome/GCF_000003025.6/>`_. `GCF_000003025.6 fna <https://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/003/025/GCF_000003025.6_Sscrofa11.1/GCF_000003025.6_Sscrofa11.1_genomic.fna.gz>`_
+- auto-detect adapters and **rabbit** + phix filtering. Includes rabbit (*Oryctolagus cuniculus*) reference `GCF_000003625.3 (OryCun2.0) <https://www.ncbi.nlm.nih.gov/data-hub/genome/GCF_000003625.3/>`_. `GCF_000003625.3 fna <https://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/003/625/GCF_000003625.3_OryCun2.0/GCF_000003625.3_OryCun2.0_genomic.fna.gz>`_
+- auto-detect adapters and **rat** + phix filtering. Includes Norway rat (*Rattus norvegicus*) reference `GCF_000001895.5 (Rnor_6.0) <https://www.ncbi.nlm.nih.gov/data-hub/genome/GCF_000001895.5/>`_. `GCF_000001895.5 fna <https://ftp.ncbi.nlm.nih.gov/genomes/all/GCA/000/001/895/GCA_000001895.4_Rnor_6.0/GCA_000001895.4_Rnor_6.0_genomic.fna.gz>`_
 - auto-detect adapters only filtering. Only includes the two adapter sequences noted above.
 
 Note that the command produces up to 6 output artifacts based on the aligner and database selected: