R# language is a kind of R liked language implements on .NET environment for the bioinformatics data analysis
[WARNING] This project is a work in progress and is not recommended for production use.
The latest sciBASIC.NET Framework runtime is also required
The R#
language its syntax is original derived from the R
language, but with more modernized programming styles. The R#
language its interpreter and .NET compiler is original writen in VisualBasic language, with native support for the .NET runtime.
The R#
language is not designed for the general data analysis purpose, but it is specialize designed for my works in the company, implements the bioinformatics data analysis system based on the GCModeller platform, for building the bioinformatics data science stack with R and VisualBasic language.
R#
The R# language core runtime and scripting engineLibrary
The fundation library in R# scripting systemRscript
The R# scripting hostR-terminal
The R# shell programRsharp_kit
The R-sharp toolkitnjl
The Julia language liked scripting enginenpy
The Python language liked scripting engineRData
The R language data*.rda/*.rds
file reader
# declare a variable
let word as string = ['world', 'R# user', 'GCModeller user'];
# declare a function
let echo as function(words) {
print( `Hello ${ words }!` );
}
# or declare a lambda function
let echo.lambda = words -> print( `Hello ${ words }!` );
# and then invoke function via pipeline operator
word :> echo;
# [3] "Hello world!" "Hello R# user!" "Hello GCModeller user!"
word :> echo.lambda;
# [3] "Hello world!" "Hello R# user!" "Hello GCModeller user!"
Used in VisualBasic.NET programming:
Dim R As New RInterpreter()
' Run script by invoke method
Call R.Evaluate("
# test script
let word as string = ['world', 'R# user', 'GCModeller user'];
let echo as function(words) {
print( `Hello ${ words }!` );
}
word :> echo;
")
' or assign variable
Call R.Add("word", {"world", "R# user", "GCModeller user"})
' then declare R function throught script
Call R.Add("echo",
Function(words As String()) As String()
Return Internal.print(words)
End Function)
' at last, invoke R function throught Invoke method
Call R.Invoke("echo", R!word)
# read scatter point data from a given table file
# and then assign to tuple variables
[x, y, cluster] = read.csv("./scatter.csv", row.names = NULL);
# umap scatter with class colors
bitmap(file = "./scatter.png") {
plot(x, y,
padding = "padding:200px 400px 200px 250px;",
class = cluster,
title = "UMAP 2D Scatter",
x.lab = "dimension 1",
y.lab = "dimension 2",
legend.block = 13,
colorSet = "paper",
grid.fill = "transparent",
size = [2600, 1600]
);
};
A R language ggplot2 package liked grammar of graphics library for R# language programming.
The R#
language is another scientific computing language which is designed for .NET runtime, R#
is evolved from the R language. There is a famous graphics library called ggplot2
in R language, so keeps the same, there is a graphics library called ggplot
was developed for R#
language.
ggplot(myeloma, aes(x = "molecular_group", y = "DEPDC1"))
+ geom_boxplot(width = 0.65)
+ geom_jitter(width = 0.3)
# Add horizontal line at base mean
+ geom_hline(yintercept = mean(myeloma$DEPDC1), linetype="dash", line.width = 6, color = "red")
+ ggtitle("DEPDC1 ~ molecular_group")
+ ylab("DEPDC1")
+ xlab("")
+ scale_y_continuous(labels = "F0")
# Add global annova p-value
+ stat_compare_means(method = "anova", label.y = 1600)
# Pairwise comparison against all
+ stat_compare_means(label = "p.signif", method = "t.test", ref.group = ".all.", hide.ns = TRUE)
+ theme(
axis.text.x = element_text(angle = 45),
plot.title = element_text(family = "Cambria Math", size = 16)
)
;
The R#
system is not only supports of the R# language, it also includes a python language scripting and Julia language scripting engine which is running upon the R#
runtime.
Reference of the python script or julia script in R#
language just like imports other R#
script:
# imports an external R# script
imports "./script.R";
# imports an external python script in R#
imports "./script.py";
# imports an external julia script in R#
imports "./script.jl";
And also you can imports R script in python or julia scripting:
# example of import R#/julia script in python
# imports an external R# script in python
import "./script.R"
# imports an external julia script in python
import "./script.jl"
imports python and R#
script in julia scripting is also keeps easy:
# example of imports R#/python script in julia
# imports an external R# script in julia
include("./script.R")
# imports an external python script in julia
include("./script.py")
require("GCModeller");
// load the fastq module from rna-seq package
// inside the GCModeller
import {FastQ} from "rnaseq";
// do short reads assembling via SCS algorithm
var assem = FastQ.assemble([
"AACAAATGAGACGCTGTGCAATTGCTGA",
"AACAAATGAGACGCTGTGCAATTGCAAA",
"CAAATGAGACGCTGTGCAATTGCTGAGT",
"GCAAATGATACGCTGTGCAATTGCTAGA",
"ATGAGACGCTGTGCAATTGCTGAGTACC",
"CTGTGCAATTGCTGAGAACAAATGAGAC",
"CTGTGCAATTGCTAGAAACAAATGAGAC"
])
// view the short reads assemble result
console.table(assem)
// Loading required package: GCModeller
// Loading required package: igraph
// Attaching package: 'igraph'
//
// The following object is masked from 'package:igraph':
//
// eval, class
//
//
//
// GCModeller: genomics CAD(Computer Assistant Design) Modeller System
// author by: [email protected]
//
// (c) 2023 | SMRUCC genomics - GuiLin, China
//
// AssembleResult
// --------------------------------------------------------------------------------------------------------------
// <mode> <string>
// [1, ] "CTGTGCAATTGCTGAGAACAAATGAGACGCTGTGCAATTGCAAATGATACGCTGTGCAATTGCTAGAAACAAATGAGACGCTGTGCAATTGCTGAGTACC"
// [2, ] "...................................................................AACAAATGAGACGCTGTGCAATTGCTGA....."
// [3, ] "................AACAAATGAGACGCTGTGCAATTGCAAA........................................................"
// [4, ] ".....................................................................CAAATGAGACGCTGTGCAATTGCTGAGT..."
// [5, ] ".......................................GCAAATGATACGCTGTGCAATTGCTAGA................................."
// [6, ] "........................................................................ATGAGACGCTGTGCAATTGCTGAGTACC"
// [7, ] "CTGTGCAATTGCTGAGAACAAATGAGAC........................................................................"
// [8, ] "...................................................CTGTGCAATTGCTAGAAACAAATGAGAC....................."
Packages that developed for the R# programming environment:
- ggplot package is a R environment ggplot2 package liked data visualization package for R# language.
- mzkit is a project developed for R# language for run data analysis of the mass spectrum raw data.
- ms-imaging is a R# package for rendering the MSImaging based on the libraries from mzkit and ggplot packages.