Skip to content

Commit

Permalink
#17 #18 #122 reviewed tests
Browse files Browse the repository at this point in the history
  • Loading branch information
@weka511
weka511 committed Mar 16, 2023
1 parent 15c7ab7 commit 7c908fc
Showing 1 changed file with 70 additions and 66 deletions.
136 changes: 70 additions & 66 deletions rosalind.py
View file
Original file line number Diff line number Diff line change
Expand Up @@ -18,10 +18,11 @@
''' Rosalind utilities and simple problems from chapters 1 through 4'''


from math import log10, ceil, sqrt
from random import randint, random
from re import compile
from sys import float_info
from math import log10, ceil, sqrt
from random import randint, random
from re import compile
from sys import float_info
from unittest import main, skip, TestCase

import numpy as np

Expand Down Expand Up @@ -1873,7 +1874,7 @@ def reconstruct_from_kmers(k,patterns):

# BA3I Find a k-Universal Circular String
# something off - I have taken this out of tests, even though the
# website accepts may answers. A small test case appears to give differnt
# website accepts my answers. A small test case appears to give different
# answers on successive runs - maybe iterating through dict is not deterministic?

def k_universal_circular_string(k):
Expand Down Expand Up @@ -2337,9 +2338,9 @@ def convolution_expanded(spectrum):

if __name__=='__main__':

import unittest

class TestRosalind(unittest.TestCase):

class TestRosalind(TestCase):

def test_fib(self):
self.assertEqual(19,fib(5,3))
Expand Down Expand Up @@ -2530,24 +2531,25 @@ def test_kmer(self):
0, 2, 1, 1],
r)

#def test_rear(self):
#self.assertEqual([9, 4, 5, 7, 0],
#rear([
#([1, 2, 3, 4, 5, 6, 7, 8, 9, 10],
#[3, 1, 5, 2, 7, 4, 9, 6, 10, 8]),
@skip('#122')
def test_rear(self):
self.assertEqual([9, 4, 5, 7, 0],
rear([
([1, 2, 3, 4, 5, 6, 7, 8, 9, 10],
[3, 1, 5, 2, 7, 4, 9, 6, 10, 8]),

#([3, 10, 8, 2, 5, 4, 7, 1, 6, 9],
#[5, 2, 3, 1, 7, 4, 10, 8, 6, 9]),
([3, 10, 8, 2, 5, 4, 7, 1, 6, 9],
[5, 2, 3, 1, 7, 4, 10, 8, 6, 9]),

#([8, 6, 7, 9, 4, 1, 3, 10, 2, 5],
#[8, 2, 7, 6, 9, 1, 5, 3, 10, 4]),
([8, 6, 7, 9, 4, 1, 3, 10, 2, 5],
[8, 2, 7, 6, 9, 1, 5, 3, 10, 4]),

#([3, 9, 10, 4, 1, 8, 6, 7, 5, 2],
#[2, 9, 8, 5, 1, 7, 3, 4, 6, 10]),
([3, 9, 10, 4, 1, 8, 6, 7, 5, 2],
[2, 9, 8, 5, 1, 7, 3, 4, 6, 10]),

#([1, 2, 3, 4, 5, 6, 7, 8, 9, 10],
#[1, 2, 3, 4, 5, 6, 7, 8, 9, 10])
#]))
([1, 2, 3, 4, 5, 6, 7, 8, 9, 10],
[1, 2, 3, 4, 5, 6, 7, 8, 9, 10])
]))

def test_tran(self):
string='''>Rosalind_0209
Expand Down Expand Up @@ -2667,7 +2669,7 @@ def test_orf(self):

### Where in the Genome does DNA replication begin? ###

class Test_1_Replication(unittest.TestCase):
class Test_1_Replication(TestCase):
def test_ba1b(self):
most_frequent_words=find_most_frequent_words('ACGTTGCATGTCGCATGATGCATGAGAGCT',4)
self.assertIn('CATG',most_frequent_words)
Expand Down Expand Up @@ -2741,7 +2743,7 @@ def test_ba1n(self):
self.assertIn('ACT', neighbours)
self.assertIn('ACG', neighbours)

class Test_2_Sequence(unittest.TestCase):
class Test_2_Sequence(TestCase):

def test_ba2a(self): # BA2A Implement MotifEnumeration
self.assertEqual('ATA ATT GTT TTT',
Expand Down Expand Up @@ -2844,7 +2846,7 @@ def test_ba2h(self):

### 3. How do we assemble genomes?

class Test_3_Assembly(unittest.TestCase):
class Test_3_Assembly(TestCase):
def test_ba3a(self):
kmers = kmer_composition(5,'CAATCCAAC')
self.assertEqual(5,len(kmers))
Expand Down Expand Up @@ -2958,47 +2960,49 @@ def test_ba3h(self):
'GCTT',
'TTAC']))

# BA3I Find a k-Universal Circular String
#def test_ba3i(self):
#self.assertEqual('0110010100001111',k_universal_circular_string(4))
@skip('#17')
def test_ba3i(self):
''' BA3I Find a k-Universal Circular String'''
self.assertEqual('0110010100001111',k_universal_circular_string(4))

# BA3J Reconstruct a String from its Paired Composition
#def test_ba3j(self):
#self.assertEqual("GTGGTCGTGAGATGTTGA",
#reconstruct_from_paired_kmers(
#4,
#2,
#['GAGA|TTGA',
#'TCGT|GATG',
#'CGTG|ATGT',
#'TGGT|TGAG',
#'GTGA|TGTT',
#'GTGG|GTGA',
#'TGAG|GTTG',
#'GGTC|GAGA',
#'GTCG|AGAT']))
#self.assertEqual('CACCGATACTGATTCTGAAGCTT',
#reconstruct_from_paired_kmers(3,
#1,
#[
#'ACC|ATA', #(ACC|ATA)
#'ACT|ATT', #(ACT|ATT)
#'ATA|TGA', #(ATA|TGA)
#'ATT|TGA', #(ATT|TGA)
#'CAC|GAT', #(CAC|GAT)
#'CCG|TAC', #(CCG|TAC)
#'CGA|ACT', #(CGA|ACT)
#'CTG|AGC', #(CTG|AGC)
#'CTG|TTC', #(CTG|TTC)
#'GAA|CTT', #(GAA|CTT)
#'GAT|CTG', #(GAT|CTG)
#'GAT|CTG', #(GAT|CTG)
#'TAC|GAT', #(TAC|GAT)
#'TCT|AAG', #(TCT|AAG)
#'TGA|GCT', #(TGA|GCT)
#'TGA|TCT', #(TGA|TCT)
#'TTC|GAA' #(TTC|GAA)
#]))
@skip('#18')
def test_ba3j(self):
'''BA3J Reconstruct a String from its Paired Composition'''
self.assertEqual("GTGGTCGTGAGATGTTGA",
reconstruct_from_paired_kmers(
4,
2,
['GAGA|TTGA',
'TCGT|GATG',
'CGTG|ATGT',
'TGGT|TGAG',
'GTGA|TGTT',
'GTGG|GTGA',
'TGAG|GTTG',
'GGTC|GAGA',
'GTCG|AGAT']))
self.assertEqual('CACCGATACTGATTCTGAAGCTT',
reconstruct_from_paired_kmers(3,
1,
[
'ACC|ATA', #(ACC|ATA)
'ACT|ATT', #(ACT|ATT)
'ATA|TGA', #(ATA|TGA)
'ATT|TGA', #(ATT|TGA)
'CAC|GAT', #(CAC|GAT)
'CCG|TAC', #(CCG|TAC)
'CGA|ACT', #(CGA|ACT)
'CTG|AGC', #(CTG|AGC)
'CTG|TTC', #(CTG|TTC)
'GAA|CTT', #(GAA|CTT)
'GAT|CTG', #(GAT|CTG)
'GAT|CTG', #(GAT|CTG)
'TAC|GAT', #(TAC|GAT)
'TCT|AAG', #(TCT|AAG)
'TGA|GCT', #(TGA|GCT)
'TGA|TCT', #(TGA|TCT)
'TTC|GAA' #(TTC|GAA)
]))

# BA3K Generate Contigs from a Collection of Reads
def test_ba3k(self):
Expand Down Expand Up @@ -3047,7 +3051,7 @@ def test_ba3m(self):
self.assertIn([6,7,6 ],paths)
self.assertEqual(4,len(paths))

class Test_4_SequenceAntibodies(unittest.TestCase):
class Test_4_SequenceAntibodies(TestCase):
# BA4B Find Substrings of a Genome Encoding a Given Amino Acid String
def test_ba4b(self):
encodings=findEncodings('ATGGCCATGGCCCCCAGAACTGAGATCAATAGTACCCGTATTAACGGGTGA','MA')
Expand Down Expand Up @@ -3132,4 +3136,4 @@ def test_ba4l(self):



unittest.main()
main()
Expand Down

0 comments on commit 7c908fc

Please sign in to comment.